Matemática, perguntado por silvajanety88, 10 meses atrás

Qual foi a linguagem utilizada no segundo quadrinho

Soluções para a tarefa

Respondido por neusadileandro

6

Resposta:

Qual

Explicação passo-a-passo:

gracilenemaria1985: hi

lumarateofilo: se você não sabe não fala nada

Respondido por karolina301

4

Não tenho como responder sem a foto do quadrinho.

Pergunta anterior

Próxima pergunta

Perguntas interessantes

Biologia, 7 meses atrás

Se uma fita de DNA contendo a sequência TACGCATCGAGTTTCGGCACT for transcrita, teremos qual das seguintes sequências? E realizando a tradução teremos que aminoácidos?

História, 7 meses atrás

alguém me ajuda pfv ♡♡...

Inglês, 7 meses atrás

3. Answer these questions and then ask your friends. Take notes in the following chart.( e depois pergunte a seus amigos. Faça as anotações na tabela a seguir.) Your answer Your friend's answer What were you doing yesterday at 6pm? Were you reading a book when your friend called you last week? Did you get good grades at school last year?

Matemática, 10 meses atrás

b) (32.35): 38 =qual é o resultado ...

Biologia, 10 meses atrás

Imaginemos, por exemplo, o estômago transformando o bolo alimentar em quimo, e o intestino delgado absorvendo nutrientes e finalizando a digestão. Apesar de cada um apresentar uma função específica, todos os órgãos do sistema digestório contribuem para uma função ainda maior:” - Qual é essa função?

Inglês, 1 ano atrás

choose the correct Answer, A, B or C for each sentence...

Filosofia, 1 ano atrás

em qual pais nasceu Aristóteles...

Inglês, 1 ano atrás

Put the verbs in brackets into the correct Present Perfect form and fill in "for" or "since" a) Paula ...... (have not) a holiday ....... last summer. b) Marie ..... (not have) a driving accident ..... she was in Spain. c) They ....... (not take) the exam ........ last May. d) I ........ (not study) so much ...... a long time. e) These students ...... (be) here ........ five years.