Biologia, perguntado por edjelmacruz93, 5 meses atrás

Moléculas de DNA com a configuração mostrada no esquema abaixo foram adicionadas a um sistema in vitro capaz de promover síntese de DNA. Qual a configuração esperada para as moléculas resultantes após a síntese ter se completado? 5’ - ATCTGCATTACGGCATTAAG - 3’Opção única.

TAGACGTAATGCCGTAAUUC

TAGACGTAATCCCCTAATTC

UAGACGUAAUGCCGUAAUUC

TAGACGTAATGCCGTAATTC

TAGACGTTTAGCCGTAATTC

Soluções para a tarefa

Respondido por camisfaryas01

1

Resposta: " d "

Explicação:

Pergunta anterior

Próxima pergunta

Perguntas interessantes

Inglês, 4 meses atrás

5. Fill in using the correct possessive form of noun. a. _____and_____ father is a bus driver (Mike, Charles) b. Those ______ clothes are old (women) c.____and____ mothers are doctors (Judy, Danny) d. Your_____ house is in the country (relatives) e. The ____ toys are expensive (boys)...

Matemática, 4 meses atrás

o estoque de alimentos do restaurante de uma empresa e suficiente para alimentar 320 operarios durante 22 dias, apos 4 dias dessa previsao, sao admitidos mais 40 operarios, quanto tempo ainda durara o estoque? alguem pode resolver isso como regra de 3?

Artes, 4 meses atrás

qual o nome do papel usado para fazer origamis?

Biologia, 5 meses atrás

Se você quiser obter maior energia, deve consumir um peixe ou alface? Justifique.

Inglês, 5 meses atrás

Enumere as 8 frases na ordem que aparece no texto 'More Wood". Two weeks later, the leader called the fox again. The skunks went to their leader for advice. The leader got an idea and phoned the weather fox. The fox said it was going to be very, very cold. The leader looked at the sky. The leader made his final phone call. The leader asked the fox how he knew about the weather. The leader didn't...

Inglês, 10 meses atrás

3) Rewrite the sentences into negative form and interrogative for a) Nancy is reading her book Nest Int - b) Joe is eating his sandwich Neg- Iar - ...

Matemática, 10 meses atrás

3) Efetue: (A) - 20 + 7 + 11 = (B) -15 - 5 - 7 = (C) 14 + 29 - 11 - 16 = (D) 29 + 33 - 72 = (E) 35 - 100 - 101 + 182 = (F) 26 - 42 + 17 + 25 - 26 =...

Matemática, 10 meses atrás

escreva na forma irredutível as razoes entre 0,08 e 0,4...